Transcript: Mouse XM_011240082.2

PREDICTED: Mus musculus family with sequence similarity 160, member A1 (Fam160a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam160a1 (229488)
Length:
4413
CDS:
266..3511

Additional Resources:

NCBI RefSeq record:
XM_011240082.2
NBCI Gene record:
Fam160a1 (229488)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240082.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178302 GCATTAGACTCGGAGTTGATA pLKO.1 2588 CDS 100% 5.625 7.875 N Fam160a1 n/a
2 TRCN0000177321 GCAAGAAGTGAAATGTAAGAA pLKO.1 3931 3UTR 100% 5.625 4.500 N Fam160a1 n/a
3 TRCN0000177706 CAGTACGACCAGATCATTCAA pLKO.1 2681 CDS 100% 5.625 3.938 N Fam160a1 n/a
4 TRCN0000198309 GCTCGTCAGCTACATTTACAA pLKO.1 1183 CDS 100% 5.625 3.938 N Fam160a1 n/a
5 TRCN0000182559 GCACTCACCAAAGATCCCATT pLKO.1 3245 CDS 100% 4.050 2.835 N Fam160a1 n/a
6 TRCN0000177181 GAAGATGTGATGTTACAGCTA pLKO.1 1463 CDS 100% 2.640 1.848 N Fam160a1 n/a
7 TRCN0000182560 GCACACAGAGAGAATCTGGAA pLKO.1 4087 3UTR 100% 2.640 1.848 N Fam160a1 n/a
8 TRCN0000182223 CCTTAGCATTAGACTCGGAGT pLKO.1 2583 CDS 100% 2.160 1.512 N Fam160a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240082.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.