Transcript: Mouse XM_011240167.2

PREDICTED: Mus musculus glutamate rich 6 (Erich6), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Erich6 (545527)
Length:
2237
CDS:
38..2227

Additional Resources:

NCBI RefSeq record:
XM_011240167.2
NBCI Gene record:
Erich6 (545527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269104 TCTGGGTATACATCAACATAC pLKO_005 1731 CDS 100% 10.800 15.120 N Erich6 n/a
2 TRCN0000283907 AGACAAGGTCTCCATTAATTT pLKO_005 1894 CDS 100% 15.000 10.500 N Erich6 n/a
3 TRCN0000269103 GATCCGGCGATTGTTCAATAA pLKO_005 2041 CDS 100% 13.200 9.240 N Erich6 n/a
4 TRCN0000269156 TTCTGCTGTTGGCCAACTTAA pLKO_005 2016 CDS 100% 13.200 9.240 N Erich6 n/a
5 TRCN0000135083 CAATGGAAATGTCTGGGTATA pLKO.1 1720 CDS 100% 10.800 7.560 N ERICH6 n/a
6 TRCN0000283909 TGGCTTTGAACCGTTACATTG pLKO_005 1854 CDS 100% 10.800 7.560 N Erich6 n/a
7 TRCN0000137062 CCAATGGAAATGTCTGGGTAT pLKO.1 1719 CDS 100% 4.050 2.835 N ERICH6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.