Transcript: Mouse XM_011240232.2

PREDICTED: Mus musculus collagen, type XXIV, alpha 1 (Col24a1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Col24a1 (71355)
Length:
7080
CDS:
572..5773

Additional Resources:

NCBI RefSeq record:
XM_011240232.2
NBCI Gene record:
Col24a1 (71355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089945 CCACAGTTCAGACATATTCAA pLKO.1 5164 CDS 100% 5.625 4.500 N Col24a1 n/a
2 TRCN0000089943 CCCTAGAACTGAAATTGTATA pLKO.1 6017 3UTR 100% 13.200 9.240 N Col24a1 n/a
3 TRCN0000089944 CCTCTCAGATGACTGCAAGAT pLKO.1 5608 CDS 100% 4.950 3.465 N Col24a1 n/a
4 TRCN0000089947 GTACAAGGTTTCAGATGGAAA pLKO.1 5284 CDS 100% 4.950 3.465 N Col24a1 n/a
5 TRCN0000089946 GTTGGAGTTTGGAGTCAGCAA pLKO.1 5410 CDS 100% 2.640 1.848 N Col24a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.