Transcript: Mouse XM_011240450.2

PREDICTED: Mus musculus inositol polyphosphate-5-phosphatase B (Inpp5b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Inpp5b (16330)
Length:
3591
CDS:
161..2941

Additional Resources:

NCBI RefSeq record:
XM_011240450.2
NBCI Gene record:
Inpp5b (16330)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311434 GGCCAGAGTTTGACCATATAA pLKO_005 2733 CDS 100% 15.000 21.000 N Inpp5b n/a
2 TRCN0000080904 CGAGTCCTTCACGATTCATAA pLKO.1 2230 CDS 100% 13.200 18.480 N Inpp5b n/a
3 TRCN0000080905 CGGATCTCCTATCCATACATT pLKO.1 2515 CDS 100% 5.625 7.875 N Inpp5b n/a
4 TRCN0000325178 CGGATCTCCTATCCATACATT pLKO_005 2515 CDS 100% 5.625 7.875 N Inpp5b n/a
5 TRCN0000080906 CCTTTGGTTCACACACCAGAA pLKO.1 501 CDS 100% 4.050 5.670 N Inpp5b n/a
6 TRCN0000080907 CCGAGTCCTTCACGATTCATA pLKO.1 2229 CDS 100% 5.625 3.938 N Inpp5b n/a
7 TRCN0000325098 CCGAGTCCTTCACGATTCATA pLKO_005 2229 CDS 100% 5.625 3.938 N Inpp5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.