Transcript: Mouse XM_011240461.2

PREDICTED: Mus musculus low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (Lrp8), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrp8 (16975)
Length:
7586
CDS:
202..3057

Additional Resources:

NCBI RefSeq record:
XM_011240461.2
NBCI Gene record:
Lrp8 (16975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240461.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178706 CGAGTGGCATTAAGTCTTGAA pLKO.1 3019 CDS 100% 4.950 6.930 N Lrp8 n/a
2 TRCN0000177833 CAGCCAAATCTGCGTGAATTA pLKO.1 1500 CDS 100% 13.200 9.240 N Lrp8 n/a
3 TRCN0000176636 CCCACATGACATTGTAATCTT pLKO.1 2355 CDS 100% 5.625 3.938 N Lrp8 n/a
4 TRCN0000177656 CCAACTATCCAGCATTGACTT pLKO.1 2160 CDS 100% 4.950 3.465 N Lrp8 n/a
5 TRCN0000176508 CAAGAGCATGAATTTCGACAA pLKO.1 2910 CDS 100% 4.050 2.835 N Lrp8 n/a
6 TRCN0000200088 CAATGGAATCACCCTGGACTT pLKO.1 2100 CDS 100% 4.050 2.835 N Lrp8 n/a
7 TRCN0000200087 CCCATCTCTGATCTTCACGAA pLKO.1 1605 CDS 100% 2.640 1.848 N Lrp8 n/a
8 TRCN0000198468 GAGGAAGATGAGCTTCACATA pLKO.1 2962 CDS 100% 4.950 2.970 N Lrp8 n/a
9 TRCN0000177978 GAGAACCTCAATAACCCACAT pLKO.1 2341 CDS 100% 4.050 2.430 N Lrp8 n/a
10 TRCN0000152515 GAAGAGGAAGAGGAAGATGAT pLKO.1 2953 CDS 100% 4.950 2.475 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240461.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.