Transcript: Mouse XM_011240485.2

PREDICTED: Mus musculus GLIS family zinc finger 1 (Glis1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Glis1 (230587)
Length:
3384
CDS:
667..3069

Additional Resources:

NCBI RefSeq record:
XM_011240485.2
NBCI Gene record:
Glis1 (230587)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082158 CTCTCCATAAGGTTCTCAAAT pLKO.1 3261 3UTR 100% 13.200 10.560 N Glis1 n/a
2 TRCN0000434302 GTGCCTCCTCAGATATCAATC pLKO_005 1466 CDS 100% 10.800 8.640 N Glis1 n/a
3 TRCN0000082161 ACAGCTCTAGTTAGCTGTGTA pLKO.1 1507 CDS 100% 0.495 0.396 N Glis1 n/a
4 TRCN0000082162 CAGCTCTAGTTAGCTGTGTAA pLKO.1 1508 CDS 100% 0.495 0.396 N Glis1 n/a
5 TRCN0000415384 GCTACCTTCTGGGCAATGAAC pLKO_005 1337 CDS 100% 4.950 3.465 N Glis1 n/a
6 TRCN0000082160 CAGTTTCCATTCCATCCAGAA pLKO.1 2754 CDS 100% 4.050 2.835 N Glis1 n/a
7 TRCN0000082159 GCTGTGTAAATGGACTCCGAA pLKO.1 1520 CDS 100% 2.640 1.848 N Glis1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.