Transcript: Mouse XM_011240497.2

PREDICTED: Mus musculus forkhead box J3 (Foxj3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Foxj3 (230700)
Length:
5559
CDS:
1075..2844

Additional Resources:

NCBI RefSeq record:
XM_011240497.2
NBCI Gene record:
Foxj3 (230700)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240497.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082211 CCGCAACAGGTATCCTGTAAT pLKO.1 2302 CDS 100% 13.200 18.480 N Foxj3 n/a
2 TRCN0000311020 TGGAAGTGTACATAGTTATAC pLKO_005 1707 CDS 100% 13.200 18.480 N Foxj3 n/a
3 TRCN0000082212 CCAATGGATTTGTGATAACTT pLKO.1 1389 CDS 100% 5.625 4.500 N Foxj3 n/a
4 TRCN0000311022 ATGCACATGGAACGGGAATTT pLKO_005 1214 CDS 100% 13.200 9.240 N Foxj3 n/a
5 TRCN0000304541 ATGTTACCAGTGCTATCTAAA pLKO_005 2929 3UTR 100% 13.200 9.240 N Foxj3 n/a
6 TRCN0000082208 CCACCGAGTAAGTCAAAGAAT pLKO.1 3387 3UTR 100% 5.625 3.938 N Foxj3 n/a
7 TRCN0000082210 GCTGAAGGAAAGCTGTCGAAT pLKO.1 2361 CDS 100% 4.950 3.465 N Foxj3 n/a
8 TRCN0000082209 CCACAGTACAACCTTCCAGAA pLKO.1 1789 CDS 100% 4.050 2.835 N Foxj3 n/a
9 TRCN0000301896 CCACAGTACAACCTTCCAGAA pLKO_005 1789 CDS 100% 4.050 2.835 N Foxj3 n/a
10 TRCN0000020802 CAGGATGACTTTGATTGGGAT pLKO.1 2812 CDS 100% 2.640 1.848 N FOXJ3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240497.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.