Transcript: Mouse XM_011240537.2

PREDICTED: Mus musculus discs, large (Drosophila) homolog-associated protein 3 (Dlgap3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dlgap3 (242667)
Length:
4037
CDS:
450..3383

Additional Resources:

NCBI RefSeq record:
XM_011240537.2
NBCI Gene record:
Dlgap3 (242667)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028261 AGCCAGGACTTATCACTATTT pLKO.1 1526 CDS 100% 13.200 18.480 N Dlgap3 n/a
2 TRCN0000028240 CCTGGAACTACAACAACTCAA pLKO.1 3113 CDS 100% 4.950 6.930 N Dlgap3 n/a
3 TRCN0000028290 GACAGCTAAGCGAAGAGTTTA pLKO.1 1825 CDS 100% 13.200 9.240 N Dlgap3 n/a
4 TRCN0000245792 AGGCCAAAGCCAGGACTTATC pLKO_005 1519 CDS 100% 10.800 7.560 N DLGAP3 n/a
5 TRCN0000028242 CCTGGTTCACTCAGTGCAGAA pLKO.1 962 CDS 100% 4.050 2.835 N Dlgap3 n/a
6 TRCN0000028214 CGAGTGGTTCATCAAGATGCT pLKO.1 2828 CDS 100% 2.640 1.848 N Dlgap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.