Transcript: Mouse XM_011240675.2

PREDICTED: Mus musculus six transmembrane epithelial antigen of prostate 2 (Steap2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Steap2 (74051)
Length:
7373
CDS:
733..2202

Additional Resources:

NCBI RefSeq record:
XM_011240675.2
NBCI Gene record:
Steap2 (74051)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253445 CTCTGACCATTCGGCTTATTA pLKO_005 860 CDS 100% 15.000 21.000 N Steap2 n/a
2 TRCN0000253447 ATGGCATAAATGGTATCAAAG pLKO_005 788 CDS 100% 10.800 15.120 N Steap2 n/a
3 TRCN0000294338 ATGGCATAAATGGTATCAAAG pLKO_005 788 CDS 100% 10.800 15.120 N STEAP2 n/a
4 TRCN0000253448 TCACGACCTTCCACGTGTTAA pLKO_005 1943 CDS 100% 13.200 9.240 N Steap2 n/a
5 TRCN0000253449 GCACTAAGTACCGCCGATTTC pLKO_005 1583 CDS 100% 10.800 6.480 N Steap2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4836 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.