Transcript: Mouse XM_011240802.2

PREDICTED: Mus musculus otoferlin (Otof), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Otof (83762)
Length:
4653
CDS:
933..4565

Additional Resources:

NCBI RefSeq record:
XM_011240802.2
NBCI Gene record:
Otof (83762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240802.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104952 CCTCCCTGATTCACAATTATA pLKO.1 4435 CDS 100% 15.000 12.000 N Otof n/a
2 TRCN0000424854 GCGCAAGCCCTGCATCTATAT pLKO_005 3050 CDS 100% 13.200 10.560 N Otof n/a
3 TRCN0000429564 ACGGTGAAGCTCACGAGTTAC pLKO_005 3985 CDS 100% 10.800 8.640 N Otof n/a
4 TRCN0000104951 GCCTCAATGATTGACCGGAAA pLKO.1 2784 CDS 100% 4.050 2.430 N Otof n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 670 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240802.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.