Transcript: Mouse XM_011240850.1

PREDICTED: Mus musculus NOL1/NOP2/Sun domain family, member 5 (Nsun5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nsun5 (100609)
Length:
2395
CDS:
54..1574

Additional Resources:

NCBI RefSeq record:
XM_011240850.1
NBCI Gene record:
Nsun5 (100609)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240850.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097513 CTGAGGATGCAATCGATTATT pLKO.1 493 CDS 100% 15.000 21.000 N Nsun5 n/a
2 TRCN0000311954 CTGAGGATGCAATCGATTATT pLKO_005 493 CDS 100% 15.000 21.000 N Nsun5 n/a
3 TRCN0000097512 CTGCCTGAGCTTCTTGTATTT pLKO.1 729 CDS 100% 13.200 9.240 N Nsun5 n/a
4 TRCN0000349358 CTGCCTGAGCTTCTTGTATTT pLKO_005 729 CDS 100% 13.200 9.240 N Nsun5 n/a
5 TRCN0000097511 GCCAAGGTGCTAGTGTATGAA pLKO.1 264 CDS 100% 5.625 3.938 N Nsun5 n/a
6 TRCN0000311953 GCCAAGGTGCTAGTGTATGAA pLKO_005 264 CDS 100% 5.625 3.938 N Nsun5 n/a
7 TRCN0000097510 GCTACATTGCAGCCCTTCTAA pLKO.1 901 CDS 100% 5.625 3.938 N Nsun5 n/a
8 TRCN0000312025 GCTACATTGCAGCCCTTCTAA pLKO_005 901 CDS 100% 5.625 3.938 N Nsun5 n/a
9 TRCN0000142689 CAAGAGACAAGGTTTCTCCTA pLKO.1 515 CDS 100% 2.640 1.848 N NSUN5 n/a
10 TRCN0000097509 GAACCATGCTTACTGTGGGAA pLKO.1 1599 3UTR 100% 2.640 1.848 N Nsun5 n/a
11 TRCN0000140865 CCAAGGTGCTAGTGTATGAGT pLKO.1 265 CDS 100% 3.000 4.200 N NSUN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240850.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.