Transcript: Mouse XM_011240917.2

PREDICTED: Mus musculus Williams-Beuren syndrome chromosome region 16 homolog (human) (Wbscr16), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rcc1l (94254)
Length:
1942
CDS:
276..1079

Additional Resources:

NCBI RefSeq record:
XM_011240917.2
NBCI Gene record:
Rcc1l (94254)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040473 CAGACAAAGGTGAAGTCTATT pLKO.1 421 CDS 100% 13.200 9.240 N Rcc1l n/a
2 TRCN0000335375 CAGACAAAGGTGAAGTCTATT pLKO_005 421 CDS 100% 13.200 9.240 N Rcc1l n/a
3 TRCN0000040475 CTTTGGTTTGACGGAGTTTAA pLKO.1 836 CDS 100% 13.200 9.240 N Rcc1l n/a
4 TRCN0000335445 CTTTGGTTTGACGGAGTTTAA pLKO_005 836 CDS 100% 13.200 9.240 N Rcc1l n/a
5 TRCN0000040477 CTGTGGCTATGGATTCACATT pLKO.1 15 5UTR 100% 4.950 3.465 N Rcc1l n/a
6 TRCN0000335374 CTGTGGCTATGGATTCACATT pLKO_005 15 5UTR 100% 4.950 3.465 N Rcc1l n/a
7 TRCN0000040474 GTGGATCACATGGTGACTCTA pLKO.1 1041 CDS 100% 4.950 3.465 N Rcc1l n/a
8 TRCN0000040476 TGCTTAGCTTTGTCCGCTGAT pLKO.1 567 CDS 100% 4.050 2.835 N Rcc1l n/a
9 TRCN0000335376 TGCTTAGCTTTGTCCGCTGAT pLKO_005 567 CDS 100% 4.050 2.835 N Rcc1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.