Transcript: Mouse XM_011240934.2

PREDICTED: Mus musculus paired immunoglobin-like type 2 receptor beta 1 (Pilrb1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pilrb1 (170741)
Length:
2157
CDS:
665..1216

Additional Resources:

NCBI RefSeq record:
XM_011240934.2
NBCI Gene record:
Pilrb1 (170741)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240934.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366461 CAGTACTTTAGTCGAGTTAAT pLKO_005 854 CDS 100% 13.200 18.480 N Pilrb1 n/a
2 TRCN0000099867 CCAGTACTTTAGTCGAGTTAA pLKO.1 853 CDS 100% 13.200 18.480 N Pilrb1 n/a
3 TRCN0000375175 TTTGGTCATAGTCCTAGTCTA pLKO_005 1078 CDS 100% 4.950 6.930 N Pilrb1 n/a
4 TRCN0000379134 ACGTGACCCAAGCACTCAACA pLKO_005 930 CDS 100% 4.950 3.960 N Pilrb1 n/a
5 TRCN0000376785 ATGAAGTTGTGGCAGTCAATT pLKO_005 893 CDS 100% 13.200 9.240 N Pilrb1 n/a
6 TRCN0000099866 CCCAGTACTTTAGTCGAGTTA pLKO.1 852 CDS 100% 4.950 3.465 N Pilrb1 n/a
7 TRCN0000375176 GGGAAGTCATCTACAACTCCT pLKO_005 723 CDS 100% 2.640 1.584 N Pilrb1 n/a
8 TRCN0000099868 GCCTTTCATACATGAGCACTT pLKO.1 748 CDS 100% 4.050 2.025 Y Pilrb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240934.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.