Transcript: Mouse XM_011241224.2

PREDICTED: Mus musculus heme binding protein 1 (Hebp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hebp1 (15199)
Length:
1230
CDS:
186..860

Additional Resources:

NCBI RefSeq record:
XM_011241224.2
NBCI Gene record:
Hebp1 (15199)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201494 CACTGTCTATTCCACGCAATT pLKO.1 671 CDS 100% 10.800 15.120 N Hebp1 n/a
2 TRCN0000435758 GCAGCATCATTCTTGAGTTAG pLKO_005 1012 3UTR 100% 10.800 15.120 N Hebp1 n/a
3 TRCN0000435325 GTCTATTACTGTGCCGGATAT pLKO_005 783 CDS 100% 10.800 15.120 N Hebp1 n/a
4 TRCN0000190891 CAGCTCCAATGTTCCTTCAAA pLKO.1 953 3UTR 100% 5.625 4.500 N Hebp1 n/a
5 TRCN0000437971 TAACGAGGTCTGGCTTGTGAA pLKO_005 833 CDS 100% 4.950 3.960 N Hebp1 n/a
6 TRCN0000201828 GAAGCAGACTATGTTGCTCAT pLKO.1 708 CDS 100% 4.050 2.835 N Hebp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.