Transcript: Mouse XM_011241236.1

PREDICTED: Mus musculus killer cell lectin-like receptor subfamily C, member 1 (Klrc1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klrc1 (16641)
Length:
2008
CDS:
88..822

Additional Resources:

NCBI RefSeq record:
XM_011241236.1
NBCI Gene record:
Klrc1 (16641)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241236.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066054 TCGAGCAGGAAATCATCTATT pLKO.1 188 CDS 100% 13.200 18.480 N Klrc1 n/a
2 TRCN0000066055 GTGGTTGTAATTACTACAGTT pLKO.1 346 CDS 100% 4.950 3.465 N Klrc1 n/a
3 TRCN0000066057 GTCTTAATTGTCGCTGTGGTT pLKO.1 331 CDS 100% 2.640 1.848 N Klrc1 n/a
4 TRCN0000066053 CCAGAGAAACTCATTGCTGGT pLKO.1 289 CDS 100% 2.160 1.512 N Klrc1 n/a
5 TRCN0000066056 TCAAGGAACCAGCACAGGAAA pLKO.1 136 CDS 100% 4.950 2.970 N Klrc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241236.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.