Transcript: Mouse XM_011241293.1

PREDICTED: Mus musculus zinc finger protein 9 (Zfp9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp9 (22750)
Length:
4160
CDS:
426..1775

Additional Resources:

NCBI RefSeq record:
XM_011241293.1
NBCI Gene record:
Zfp9 (22750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435475 ATTAGGTAGACCTTGACAATA pLKO_005 1926 3UTR 100% 13.200 18.480 N Zfp9 n/a
2 TRCN0000417751 TGGTTAAGCCAAGTGTGATTG pLKO_005 577 CDS 100% 10.800 15.120 N Zfp9 n/a
3 TRCN0000413058 GCTAACAAGTAGCGCAAGTTC pLKO_005 1764 CDS 100% 4.950 6.930 N Zfp9 n/a
4 TRCN0000421169 GTCGTCTCTCACTAGACATCT pLKO_005 962 CDS 100% 4.950 3.960 N Zfp9 n/a
5 TRCN0000084866 ACACACCAAGAAGTCCTATAA pLKO.1 824 CDS 100% 13.200 9.240 N Zfp9 n/a
6 TRCN0000427613 ATGTGGACAAGCTTTCTATAA pLKO_005 854 CDS 100% 13.200 9.240 N Zfp9 n/a
7 TRCN0000084865 CCATGGCCATTAGAAGAATTT pLKO.1 621 CDS 100% 13.200 9.240 N Zfp9 n/a
8 TRCN0000424103 GTGAACTCAGTCCTTAGATTA pLKO_005 1545 CDS 100% 13.200 9.240 N Zfp9 n/a
9 TRCN0000420888 ACCTGTTCTCTGTGGGTTATC pLKO_005 553 CDS 100% 10.800 7.560 N Zfp9 n/a
10 TRCN0000417593 CTCTCATAGCATCTAGCATTA pLKO_005 2111 3UTR 100% 10.800 7.560 N Zfp9 n/a
11 TRCN0000423314 GCCATACGAGTGTGAGATATG pLKO_005 1592 CDS 100% 10.800 7.560 N Zfp9 n/a
12 TRCN0000418062 ACGAAGACCTCACAATCCATC pLKO_005 877 CDS 100% 4.050 2.835 N Zfp9 n/a
13 TRCN0000084864 CGGAAACTGCTTCTACCAGAA pLKO.1 1361 CDS 100% 4.050 2.835 N Zfp9 n/a
14 TRCN0000084867 CAGTGTGATAAATCCTTCTAT pLKO.1 1020 CDS 100% 5.625 3.375 N Zfp9 n/a
15 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 2584 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
16 TRCN0000084863 CCTGAGTTCAATTCCCAGTAA pLKO.1 2545 3UTR 100% 4.950 2.475 Y Zfp9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.