Transcript: Mouse XM_011241385.2

PREDICTED: Mus musculus diacylglycerol kinase, iota (Dgki), transcript variant X15, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dgki (320127)
Length:
13211
CDS:
112..3216

Additional Resources:

NCBI RefSeq record:
XM_011241385.2
NBCI Gene record:
Dgki (320127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221696 GATCTATCCAAACACGTCAAA pLKO.1 1828 CDS 100% 4.950 6.930 N Dgki n/a
2 TRCN0000221695 CGTATGTACATAGACCGTCTA pLKO.1 2395 CDS 100% 4.050 5.670 N Dgki n/a
3 TRCN0000221693 GCTACATTGAAGTCATTGGAT pLKO.1 2003 CDS 100% 3.000 4.200 N Dgki n/a
4 TRCN0000360962 AGCTAATGGAATCCATATTTG pLKO_005 3296 3UTR 100% 13.200 9.240 N Dgki n/a
5 TRCN0000360969 CTGTAACCACCCATCGATTTA pLKO_005 3596 3UTR 100% 13.200 9.240 N Dgki n/a
6 TRCN0000360965 TGCTTCATGCTGCATCATATT pLKO_005 991 CDS 100% 13.200 9.240 N Dgki n/a
7 TRCN0000360964 TTTGATGCTCACGTCACATTG pLKO_005 1696 CDS 100% 10.800 7.560 N Dgki n/a
8 TRCN0000025389 CCTGCTTCATGCTGCATCATA pLKO.1 989 CDS 100% 5.625 3.938 N LOC381757 n/a
9 TRCN0000025391 TGGATCATTAAGGTGAAGAAA pLKO.1 1063 CDS 100% 5.625 3.938 N LOC381757 n/a
10 TRCN0000221692 CCTCTGGGTATTCTAGTTGTT pLKO.1 2347 CDS 100% 4.950 3.465 N Dgki n/a
11 TRCN0000025392 GCCGGACAGAAAGAGAAGGAA pLKO.1 421 CDS 100% 3.000 2.100 N LOC381757 n/a
12 TRCN0000025393 GAAGCAGGTCTCTTACAGGAA pLKO.1 480 CDS 100% 2.640 1.848 N LOC381757 n/a
13 TRCN0000006091 CCAGATATTGTGCTGGCACAA pLKO.1 1925 CDS 100% 0.405 0.284 N DGKI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.