Transcript: Mouse XM_011241473.1

PREDICTED: Mus musculus Nanog homeobox (Nanog), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nanog (71950)
Length:
2803
CDS:
832..1725

Additional Resources:

NCBI RefSeq record:
XM_011241473.1
NBCI Gene record:
Nanog (71950)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225960 CCGAGAACTATTCTTGCTTAC pLKO_005 902 CDS 100% 6.000 8.400 N Nanogpd n/a
2 TRCN0000225963 GGCTATCTGGTGAACGCATCT pLKO_005 1363 CDS 100% 4.050 5.670 N Nanogpd n/a
3 TRCN0000075333 GCCAACCTGTACTATGTTTAA pLKO.1 2572 3UTR 100% 13.200 10.560 N Nanog n/a
4 TRCN0000075337 CTTGCTTACAAGGGTCTGCTA pLKO.1 914 CDS 100% 2.640 2.112 N Nanog n/a
5 TRCN0000218759 CATTCTGAACCTGAGCTATAA pLKO_005 1200 CDS 100% 13.200 9.240 N Nanogpd n/a
6 TRCN0000225961 AGACTAGCAATGGTCTGATTC pLKO_005 1289 CDS 100% 10.800 7.560 N Nanogpd n/a
7 TRCN0000075335 CCTGAGCTATAAGCAGGTTAA pLKO.1 1209 CDS 100% 10.800 7.560 N Nanog n/a
8 TRCN0000075334 GCCAGTGATTTGGAGGTGAAT pLKO.1 1609 CDS 100% 4.950 3.465 N Nanog n/a
9 TRCN0000075336 CCAGTGGTTGAAGACTAGCAA pLKO.1 1278 CDS 100% 3.000 2.100 N Nanog n/a
10 TRCN0000225962 GGAGTATCCCAGCATCCATTG pLKO_005 1329 CDS 100% 6.000 3.600 N Nanogpd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.