Transcript: Mouse XM_011241476.1

PREDICTED: Mus musculus dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (Dusp11), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dusp11 (72102)
Length:
5532
CDS:
240..692

Additional Resources:

NCBI RefSeq record:
XM_011241476.1
NBCI Gene record:
Dusp11 (72102)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241476.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314765 CTACCTCATTTGCAGATATTT pLKO_005 203 5UTR 100% 15.000 21.000 N DUSP11 n/a
2 TRCN0000081479 CCCATACTACTGGGAATGGAA pLKO.1 665 CDS 100% 3.000 4.200 N Dusp11 n/a
3 TRCN0000002928 GCTACCTCATTTGCAGATATT pLKO.1 202 5UTR 100% 13.200 9.240 N DUSP11 n/a
4 TRCN0000081478 GCCCTTTGATTTGACTCCTTT pLKO.1 2636 3UTR 100% 4.950 3.465 N Dusp11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241476.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.