Transcript: Mouse XM_011241511.2

PREDICTED: Mus musculus transmembrane protein 40 (Tmem40), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem40 (94346)
Length:
1307
CDS:
96..773

Additional Resources:

NCBI RefSeq record:
XM_011241511.2
NBCI Gene record:
Tmem40 (94346)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241511.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194013 GAAACGGAAGATCACTACCAA pLKO.1 150 CDS 100% 3.000 4.200 N Tmem40 n/a
2 TRCN0000175378 CCATTGCTCATAGGTCAACAT pLKO.1 1021 3UTR 100% 4.950 3.960 N Tmem40 n/a
3 TRCN0000174968 GATATAAGAGAGACAAGTCTT pLKO.1 211 CDS 100% 4.950 3.960 N Tmem40 n/a
4 TRCN0000173258 CATCTATTTCGGGCTCGTGTA pLKO.1 674 CDS 100% 4.050 3.240 N Tmem40 n/a
5 TRCN0000174436 CCACACAATAAAGAGCTCTTT pLKO.1 879 3UTR 100% 4.950 3.465 N Tmem40 n/a
6 TRCN0000175256 CTGAACATAAAGAAGGATGAT pLKO.1 525 CDS 100% 4.950 3.465 N Tmem40 n/a
7 TRCN0000173367 GCCATTGCTCATAGGTCAACA pLKO.1 1020 3UTR 100% 4.950 3.465 N Tmem40 n/a
8 TRCN0000173259 CGGAAGATCACTACCAAGAGA pLKO.1 154 CDS 100% 3.000 2.100 N Tmem40 n/a
9 TRCN0000173300 GAAGTGCTAAAGGACGAGCTT pLKO.1 393 CDS 100% 2.640 1.848 N Tmem40 n/a
10 TRCN0000176441 CCTCTCAGTTAAGAAGACTGA pLKO.1 508 CDS 100% 0.264 0.185 N Tmem40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241511.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.