Transcript: Mouse XM_011241564.2

PREDICTED: Mus musculus pleckstrin homology domain containing, family A member 5 (Plekha5), transcript variant X36, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plekha5 (109135)
Length:
3332
CDS:
527..3286

Additional Resources:

NCBI RefSeq record:
XM_011241564.2
NBCI Gene record:
Plekha5 (109135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241564.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329300 ACGGGCAAGATAGACCATTAA pLKO_005 1542 CDS 100% 13.200 18.480 N Plekha5 n/a
2 TRCN0000192945 GCAGGTATTGATGCCAAATTA pLKO.1 2732 CDS 100% 15.000 10.500 N Plekha5 n/a
3 TRCN0000190848 GCAGATTGTGTGAACAGGATA pLKO.1 2754 CDS 100% 4.950 3.465 N Plekha5 n/a
4 TRCN0000190596 GCAGTGGATTAAAGTCCAGAA pLKO.1 1792 CDS 100% 4.050 2.835 N Plekha5 n/a
5 TRCN0000329364 GCAGTGGATTAAAGTCCAGAA pLKO_005 1792 CDS 100% 4.050 2.835 N Plekha5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241564.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.