Transcript: Mouse XM_011241566.2

PREDICTED: Mus musculus branched chain aminotransferase 1, cytosolic (Bcat1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bcat1 (12035)
Length:
8193
CDS:
608..1765

Additional Resources:

NCBI RefSeq record:
XM_011241566.2
NBCI Gene record:
Bcat1 (12035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241566.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103175 CCCAGCACATAGTAGGTATTT pLKO.1 2555 3UTR 100% 13.200 9.240 N Bcat1 n/a
2 TRCN0000317123 CCCAGCACATAGTAGGTATTT pLKO_005 2555 3UTR 100% 13.200 9.240 N Bcat1 n/a
3 TRCN0000103179 GATGGGAGAAACCTCACATTA pLKO.1 804 CDS 100% 13.200 9.240 N Bcat1 n/a
4 TRCN0000317184 GATGGGAGAAACCTCACATTA pLKO_005 804 CDS 100% 13.200 9.240 N Bcat1 n/a
5 TRCN0000103176 CGGACCTCAACATGGATAGAA pLKO.1 942 CDS 100% 5.625 3.938 N Bcat1 n/a
6 TRCN0000103178 CCTTCCAAAGCCCTACTCTTT pLKO.1 1136 CDS 100% 4.950 3.465 N Bcat1 n/a
7 TRCN0000317122 CCTTCCAAAGCCCTACTCTTT pLKO_005 1136 CDS 100% 4.950 3.465 N Bcat1 n/a
8 TRCN0000103177 GCATATTCCAACGATGGAGAA pLKO.1 1654 CDS 100% 4.050 2.835 N Bcat1 n/a
9 TRCN0000317186 GCATATTCCAACGATGGAGAA pLKO_005 1654 CDS 100% 4.050 2.835 N Bcat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241566.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.