Transcript: Mouse XM_011241657.1

PREDICTED: Mus musculus ADP-ribosyltransferase 1 (Art1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Art1 (11870)
Length:
1450
CDS:
118..1095

Additional Resources:

NCBI RefSeq record:
XM_011241657.1
NBCI Gene record:
Art1 (11870)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110341 CGCAGTACATACAACTGTGAA pLKO.1 916 CDS 100% 4.950 6.930 N Art1 n/a
2 TRCN0000110344 GCGTCCTTTGATGACCAGTAT pLKO.1 247 CDS 100% 4.950 6.930 N Art1 n/a
3 TRCN0000110342 CGAAACTTTCCAGGTGATCAA pLKO.1 840 CDS 100% 4.950 3.960 N Art1 n/a
4 TRCN0000110343 GCCAACAAAGTATACGCGGAT pLKO.1 328 CDS 100% 2.160 1.512 N Art1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.