Transcript: Mouse XM_011242044.2

PREDICTED: Mus musculus chemokine (C-C motif) ligand 25 (Ccl25), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccl25 (20300)
Length:
975
CDS:
161..595

Additional Resources:

NCBI RefSeq record:
XM_011242044.2
NBCI Gene record:
Ccl25 (20300)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067916 GCGATGAGAATCTTGACAGCT pLKO.1 410 CDS 100% 2.640 3.696 N Ccl25 n/a
2 TRCN0000375753 GCTGAGGGAAGGGAGTAATTT pLKO_005 802 3UTR 100% 15.000 12.000 N Ccl25 n/a
3 TRCN0000067914 CCAGCACAGGATCAAATGGAA pLKO.1 262 CDS 100% 3.000 2.400 N Ccl25 n/a
4 TRCN0000334295 CCAGCACAGGATCAAATGGAA pLKO_005 262 CDS 100% 3.000 2.400 N Ccl25 n/a
5 TRCN0000348238 TCAGGCAAGCAACCCTAATTA pLKO_005 891 3UTR 100% 15.000 10.500 N Ccl25 n/a
6 TRCN0000067913 GCCCAGAAAGACCAACAATTA pLKO.1 574 CDS 100% 13.200 9.240 N Ccl25 n/a
7 TRCN0000067917 AGATTCTACTTCCGCCAGAAA pLKO.1 350 CDS 100% 4.950 3.465 N Ccl25 n/a
8 TRCN0000334296 AGATTCTACTTCCGCCAGAAA pLKO_005 350 CDS 100% 4.950 3.465 N Ccl25 n/a
9 TRCN0000067915 CCAGAAAGTAGTGTGTGGGAA pLKO.1 364 CDS 100% 2.640 1.848 N Ccl25 n/a
10 TRCN0000334297 CCAGAAAGTAGTGTGTGGGAA pLKO_005 364 CDS 100% 2.640 1.848 N Ccl25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.