Transcript: Mouse XM_011242512.2

PREDICTED: Mus musculus beta-site APP cleaving enzyme 1 (Bace1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bace1 (23821)
Length:
3437
CDS:
16..1326

Additional Resources:

NCBI RefSeq record:
XM_011242512.2
NBCI Gene record:
Bace1 (23821)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321080 TGGTATCGACCACTCGCTATA pLKO_005 534 CDS 100% 10.800 15.120 N Bace1 n/a
2 TRCN0000009496 CAGTGGAAGGTCCGTTTGTTA pLKO.1 1109 CDS 100% 5.625 7.875 N Bace1 n/a
3 TRCN0000321081 CAAGCCTACACTGGTACAAAG pLKO_005 1819 3UTR 100% 10.800 8.640 N Bace1 n/a
4 TRCN0000321082 ATCGAGCCCGAAAGCGAATTG pLKO_005 1040 CDS 100% 10.800 7.560 N Bace1 n/a
5 TRCN0000009495 CGTCATCATGGAAGGTTTCTA pLKO.1 1008 CDS 100% 5.625 3.938 N Bace1 n/a
6 TRCN0000321005 CGTCATCATGGAAGGTTTCTA pLKO_005 1008 CDS 100% 5.625 3.938 N Bace1 n/a
7 TRCN0000009494 CATCACTGAATCGGACAAGTT pLKO.1 306 CDS 100% 4.950 3.465 N Bace1 n/a
8 TRCN0000321004 CATCACTGAATCGGACAAGTT pLKO_005 306 CDS 100% 4.950 3.465 N Bace1 n/a
9 TRCN0000009493 CGTGTGGAAATCAATGGTCAA pLKO.1 616 CDS 100% 4.050 2.835 N Bace1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.