Transcript: Mouse XM_011242542.3

PREDICTED: Mus musculus FAT atypical cadherin 3 (Fat3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Fat3 (270120)
Length:
19354
CDS:
805..14544

Additional Resources:

NCBI RefSeq record:
XM_011242542.3
NBCI Gene record:
Fat3 (270120)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242542.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097313 GCACCTGTAATGGAGGAGTTT pLKO.1 12227 CDS 100% 4.950 3.960 N Fat3 n/a
2 TRCN0000097310 GCAGAGAAACTACTCATTAAA pLKO.1 2881 CDS 100% 15.000 10.500 N Fat3 n/a
3 TRCN0000097309 CCCACAACAAAGAGGACTTTA pLKO.1 18780 3UTR 100% 13.200 9.240 N Fat3 n/a
4 TRCN0000097312 GCTGTGTTTGAAACTGTCTTA pLKO.1 6529 CDS 100% 4.950 3.465 N Fat3 n/a
5 TRCN0000097311 GCCAAACTTTATGTTCACATT pLKO.1 1552 CDS 100% 4.950 2.970 N Fat3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242542.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.