Transcript: Mouse XM_011242554.2

PREDICTED: Mus musculus dedicator of cytokinesis 6 (Dock6), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dock6 (319899)
Length:
6538
CDS:
119..6361

Additional Resources:

NCBI RefSeq record:
XM_011242554.2
NBCI Gene record:
Dock6 (319899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249923 TAGCGGACCGAGGCTACATTT pLKO_005 3237 CDS 100% 13.200 18.480 N Dock6 n/a
2 TRCN0000249922 TGCGCCAGAACTTCGAGATTG pLKO_005 4683 CDS 100% 10.800 15.120 N Dock6 n/a
3 TRCN0000257944 GCGTGTATTTGGGACATATTT pLKO_005 5452 CDS 100% 15.000 10.500 N Dock6 n/a
4 TRCN0000249924 CCTAAACTCGGACTCCGTTAA pLKO_005 1015 CDS 100% 10.800 7.560 N Dock6 n/a
5 TRCN0000183543 GAGTTTCCAGTTGATGACTTA pLKO.1 347 CDS 100% 4.950 3.465 N Dock6 n/a
6 TRCN0000183960 CTCACAAGATCAACAGGACTG pLKO.1 147 CDS 100% 2.250 1.575 N Dock6 n/a
7 TRCN0000257967 GGCTAAGAGCCACACCCAGAA pLKO_005 6365 3UTR 100% 1.350 0.945 N Dock6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.