Transcript: Mouse XM_011242657.2

PREDICTED: Mus musculus a disintegrin and metallopeptidase domain 10 (Adam10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adam10 (11487)
Length:
4760
CDS:
364..2625

Additional Resources:

NCBI RefSeq record:
XM_011242657.2
NBCI Gene record:
Adam10 (11487)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242657.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031848 CCAGGAGAGTCTAAGAACTTA pLKO.1 1579 CDS 100% 5.625 3.938 N Adam10 n/a
2 TRCN0000323778 CCAGGAGAGTCTAAGAACTTA pLKO_005 1579 CDS 100% 5.625 3.938 N Adam10 n/a
3 TRCN0000031844 GCAGAGAGATACATTAAAGAT pLKO.1 793 CDS 100% 5.625 3.938 N Adam10 n/a
4 TRCN0000323714 GCAGAGAGATACATTAAAGAT pLKO_005 793 CDS 100% 5.625 3.938 N Adam10 n/a
5 TRCN0000031847 CAGCTCTATATCCAGACAGAT pLKO.1 1045 CDS 100% 4.950 3.465 N Adam10 n/a
6 TRCN0000323782 CAGCTCTATATCCAGACAGAT pLKO_005 1045 CDS 100% 4.950 3.465 N Adam10 n/a
7 TRCN0000031845 CCATGTTTGCTGCATGAAGAA pLKO.1 2160 CDS 100% 4.950 3.465 N Adam10 n/a
8 TRCN0000323716 CCATGTTTGCTGCATGAAGAA pLKO_005 2160 CDS 100% 4.950 3.465 N Adam10 n/a
9 TRCN0000031846 GAGTTATCAAATGGGACACAT pLKO.1 2595 CDS 100% 4.950 3.465 N Adam10 n/a
10 TRCN0000323715 GAGTTATCAAATGGGACACAT pLKO_005 2595 CDS 100% 4.950 3.465 N Adam10 n/a
11 TRCN0000006674 CCCTACAAATCCTTTCCGTTT pLKO.1 1233 CDS 100% 4.050 2.835 N ADAM10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242657.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.