Transcript: Mouse XM_011242675.2

PREDICTED: Mus musculus phospholipid scramblase 2 (Plscr2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plscr2 (18828)
Length:
2359
CDS:
753..1829

Additional Resources:

NCBI RefSeq record:
XM_011242675.2
NBCI Gene record:
Plscr2 (18828)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363795 GGCCTTCACGGATTCGGATAA pLKO_005 1706 CDS 100% 10.800 15.120 N Plscr2 n/a
2 TRCN0000105234 CTTCACGGATTCGGATAACTT pLKO.1 1709 CDS 100% 5.625 7.875 N Plscr2 n/a
3 TRCN0000105231 CCTGGGCTAGAATACTTAAAT pLKO.1 1188 CDS 100% 15.000 10.500 N Plscr2 n/a
4 TRCN0000375573 TGCACCTGCTGTTCAGATATT pLKO_005 1608 CDS 100% 13.200 9.240 N Plscr2 n/a
5 TRCN0000105230 GACGAAGAGAAGTGTATGTTT pLKO.1 2097 3UTR 100% 5.625 3.938 N Plscr2 n/a
6 TRCN0000352055 GACGAAGAGAAGTGTATGTTT pLKO_005 2097 3UTR 100% 5.625 3.938 N Plscr2 n/a
7 TRCN0000105232 GCCAAAGCTCACTCTTCAGAA pLKO.1 1541 CDS 100% 4.950 3.465 N Plscr2 n/a
8 TRCN0000352053 GCCAAAGCTCACTCTTCAGAA pLKO_005 1541 CDS 100% 4.950 3.465 N Plscr2 n/a
9 TRCN0000105233 CTTGATGAAGTGACTAGAATT pLKO.1 1647 CDS 100% 0.000 0.000 N Plscr2 n/a
10 TRCN0000352135 CTTGATGAAGTGACTAGAATT pLKO_005 1647 CDS 100% 0.000 0.000 N Plscr2 n/a
11 TRCN0000375574 CGTCTAGACCTTTCACTTTAA pLKO_005 1366 CDS 100% 13.200 7.920 N Plscr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.