Transcript: Mouse XM_011242725.1

PREDICTED: Mus musculus zinc finger protein of the cerebellum 4 (Zic4), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zic4 (22774)
Length:
4786
CDS:
1612..2652

Additional Resources:

NCBI RefSeq record:
XM_011242725.1
NBCI Gene record:
Zic4 (22774)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242725.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415812 GGGAAGGTCTTTGCTAGATCA pLKO_005 2245 CDS 100% 4.950 3.465 N ZIC4 n/a
2 TRCN0000075542 CGACAAGCCTTATATGTGCAA pLKO.1 2391 CDS 100% 2.640 1.848 N Zic4 n/a
3 TRCN0000075540 GCAGGCTAACCACATTTGCTT pLKO.1 2112 CDS 100% 3.000 1.800 N Zic4 n/a
4 TRCN0000074201 GCCCTTCAAAGCCAAATACAA pLKO.1 2160 CDS 100% 5.625 2.813 Y ZIC4 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 137 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242725.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.