Transcript: Mouse XM_011242743.2

PREDICTED: Mus musculus 5'-3' exoribonuclease 1 (Xrn1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xrn1 (24127)
Length:
5775
CDS:
108..3905

Additional Resources:

NCBI RefSeq record:
XM_011242743.2
NBCI Gene record:
Xrn1 (24127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242743.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296741 CGATGTTGTACAAGGTATAAA pLKO_005 1977 CDS 100% 15.000 21.000 N XRN1 n/a
2 TRCN0000329112 CGATGTTGTACAAGGTATAAA pLKO_005 1977 CDS 100% 15.000 21.000 N Xrn1 n/a
3 TRCN0000375261 GTGGTATTAATACCGTTTATT pLKO_005 1794 CDS 100% 15.000 10.500 N Xrn1 n/a
4 TRCN0000119942 GCCTCTTCTTTATGGAACATA pLKO.1 1028 CDS 100% 5.625 3.938 N Xrn1 n/a
5 TRCN0000119943 CCCTACTTTGAAACACATCAA pLKO.1 2084 CDS 100% 4.950 3.465 N Xrn1 n/a
6 TRCN0000329056 CCCTACTTTGAAACACATCAA pLKO_005 2084 CDS 100% 4.950 3.465 N Xrn1 n/a
7 TRCN0000119944 GCCTGTTATGTTCAGGCTATA pLKO.1 1476 CDS 100% 1.080 0.756 N Xrn1 n/a
8 TRCN0000119946 CCTACTTTGAAACACATCAAA pLKO.1 2085 CDS 100% 0.563 0.394 N Xrn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242743.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.