Transcript: Mouse XM_011242936.1

PREDICTED: Mus musculus microtubule-associated protein 4 (Map4), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map4 (17758)
Length:
5491
CDS:
20..3283

Additional Resources:

NCBI RefSeq record:
XM_011242936.1
NBCI Gene record:
Map4 (17758)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306373 AGAGTGGACTATCCGGATTAT pLKO_005 338 CDS 100% 13.200 18.480 N Map4 n/a
2 TRCN0000089879 CCACGCTAACAATATCATATT pLKO.1 949 CDS 100% 13.200 18.480 N Map4 n/a
3 TRCN0000089880 GCCCACGCTAACAATATCATA pLKO.1 947 CDS 100% 5.625 7.875 N Map4 n/a
4 TRCN0000332301 GCCCACGCTAACAATATCATA pLKO_005 947 CDS 100% 5.625 7.875 N Map4 n/a
5 TRCN0000306374 CCACGAACGCTTCTGCATTTA pLKO_005 495 CDS 100% 13.200 9.240 N Map4 n/a
6 TRCN0000311528 GCCAACTCCAACTTCACTATC pLKO_005 3647 3UTR 100% 10.800 7.560 N Map4 n/a
7 TRCN0000306432 GCCATCTACTGAATCGGATAT pLKO_005 883 CDS 100% 10.800 7.560 N Map4 n/a
8 TRCN0000089878 CCCTCCTTGATGTTGATCTTA pLKO.1 5180 3UTR 100% 5.625 3.938 N Map4 n/a
9 TRCN0000089881 GCAGAACAAATGTCTACCTTA pLKO.1 1832 CDS 100% 4.950 3.465 N Map4 n/a
10 TRCN0000089882 CCTCCAGAAATTGAGGGAGAA pLKO.1 59 CDS 100% 4.050 2.835 N Map4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.