Transcript: Mouse XM_011243052.2

PREDICTED: Mus musculus oxysterol binding protein-like 10 (Osbpl10), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Osbpl10 (74486)
Length:
2383
CDS:
293..2311

Additional Resources:

NCBI RefSeq record:
XM_011243052.2
NBCI Gene record:
Osbpl10 (74486)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243052.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105027 GTCATTAGCTTCGTGGAGTAT pLKO.1 1379 CDS 100% 4.950 6.930 N Osbpl10 n/a
2 TRCN0000105025 CGAAGAAGAACAGAGCGACAA pLKO.1 1141 CDS 100% 4.050 3.240 N Osbpl10 n/a
3 TRCN0000105028 GAAGAGCCAAGAGTCAGTATT pLKO.1 699 CDS 100% 13.200 9.240 N Osbpl10 n/a
4 TRCN0000413488 GAGATGTACGCAGACTTTATG pLKO_005 1304 CDS 100% 13.200 9.240 N Osbpl10 n/a
5 TRCN0000416568 GGTGCAGTGCTTCCCGTAATA pLKO_005 2320 3UTR 100% 13.200 9.240 N Osbpl10 n/a
6 TRCN0000105026 CTGAAGTGAAACACAACCCAA pLKO.1 1938 CDS 100% 2.640 1.848 N Osbpl10 n/a
7 TRCN0000105029 GCCTGTGTATCCTAAGAAGCT pLKO.1 2056 CDS 100% 2.640 1.848 N Osbpl10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243052.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.