Transcript: Mouse XM_011243129.2

PREDICTED: Mus musculus human immunodeficiency virus type I enhancer binding protein 2 (Hivep2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hivep2 (15273)
Length:
9899
CDS:
1591..8883

Additional Resources:

NCBI RefSeq record:
XM_011243129.2
NBCI Gene record:
Hivep2 (15273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243129.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095775 CGGAGTAAATCGTTTGATTAT pLKO.1 4705 CDS 100% 13.200 18.480 N Hivep2 n/a
2 TRCN0000271869 TTCGTCATTGATCAGCTATTT pLKO_005 7437 CDS 100% 13.200 18.480 N Hivep2 n/a
3 TRCN0000022094 CGGCCTTATGTATGCAAGTTA pLKO.1 7015 CDS 100% 5.625 7.875 N HIVEP2 n/a
4 TRCN0000284539 GTCGCCTCTGAGGACCTATTT pLKO_005 1987 CDS 100% 13.200 10.560 N Hivep2 n/a
5 TRCN0000271872 CATGTTGAAGACCACGAAATT pLKO_005 3063 CDS 100% 13.200 9.240 N Hivep2 n/a
6 TRCN0000284573 CTTGGATCTAAACGATGTAAA pLKO_005 9246 3UTR 100% 13.200 9.240 N Hivep2 n/a
7 TRCN0000095777 GCCGTAAACCATACAAGAAAT pLKO.1 3512 CDS 100% 13.200 9.240 N Hivep2 n/a
8 TRCN0000284538 GTGCGAAACCCAGCGTCTTAA pLKO_005 2183 CDS 100% 13.200 9.240 N Hivep2 n/a
9 TRCN0000095774 GCTCTGATTCTGTAATACTAA pLKO.1 9347 3UTR 100% 5.625 3.938 N Hivep2 n/a
10 TRCN0000095778 GCAATGAACCTTCACCAGAAA pLKO.1 8846 CDS 100% 4.950 3.465 N Hivep2 n/a
11 TRCN0000236545 TTTGGACACTTGGATCTAAAT pLKO_005 9238 3UTR 100% 13.200 9.240 N HIVEP2 n/a
12 TRCN0000022095 GCCTTGTTTCAGTTTCAGTAT pLKO.1 5164 CDS 100% 4.950 3.465 N HIVEP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243129.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.