Transcript: Mouse XM_011243136.1

PREDICTED: Mus musculus mannosidase 1, alpha (Man1a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Man1a (17155)
Length:
4083
CDS:
16..1431

Additional Resources:

NCBI RefSeq record:
XM_011243136.1
NBCI Gene record:
Man1a (17155)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018472 CCGGAAGCGTTTCGATTTGAT pLKO.1 1030 CDS 100% 5.625 7.875 N Man1a n/a
2 TRCN0000294542 CCGGAAGCGTTTCGATTTGAT pLKO_005 1030 CDS 100% 5.625 7.875 N Man1a n/a
3 TRCN0000018471 CAATAGTAGATGCCCTGGATA pLKO.1 188 CDS 100% 4.950 6.930 N Man1a n/a
4 TRCN0000055386 CCCGCACTTGTCATGAATCTT pLKO.1 983 CDS 100% 5.625 4.500 N Man1a n/a
5 TRCN0000055384 GTTATGACGATGTCCAGCAAA pLKO.1 1259 CDS 100% 4.950 3.960 N Man1a n/a
6 TRCN0000287163 GTTATGACGATGTCCAGCAAA pLKO_005 1259 CDS 100% 4.950 3.960 N Man1a n/a
7 TRCN0000018474 GCTTGAACGAACTGAAACCTA pLKO.1 116 CDS 100% 3.000 2.400 N Man1a n/a
8 TRCN0000294544 GCTTGAACGAACTGAAACCTA pLKO_005 116 CDS 100% 3.000 2.400 N Man1a n/a
9 TRCN0000055385 CCGTGAACAGAAGAAGGAAAT pLKO.1 1392 CDS 100% 10.800 7.560 N Man1a n/a
10 TRCN0000049600 CCTTTATCCTAACTATCTGAA pLKO.1 633 CDS 100% 4.950 3.465 N MAN1A1 n/a
11 TRCN0000055383 CGAAAGAAAGCAGTGGAACTT pLKO.1 373 CDS 100% 4.950 3.465 N Man1a n/a
12 TRCN0000018473 GTGTTGAACAAACTGGACAAA pLKO.1 604 CDS 100% 4.950 3.465 N Man1a n/a
13 TRCN0000018470 CCTTTCCCTATACTCCGTGAA pLKO.1 1378 CDS 100% 4.050 2.835 N Man1a n/a
14 TRCN0000294628 CCTTTCCCTATACTCCGTGAA pLKO_005 1378 CDS 100% 4.050 2.835 N Man1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.