Transcript: Mouse XM_011243144.2

PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, K (Ptprk), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptprk (19272)
Length:
6450
CDS:
601..4983

Additional Resources:

NCBI RefSeq record:
XM_011243144.2
NBCI Gene record:
Ptprk (19272)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243144.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220443 GCCGGGTGAAATGCTATAAAT pLKO.1 3635 CDS 100% 15.000 21.000 N Ptprk n/a
2 TRCN0000353475 TTACGATCTCGGCGCATTAAT pLKO_005 4012 CDS 100% 15.000 21.000 N Ptprk n/a
3 TRCN0000336469 TGTTACTGCACCGAGAGATTT pLKO_005 5054 3UTR 100% 13.200 18.480 N Ptprk n/a
4 TRCN0000220447 CGTCACTATCTGCTACCATTA pLKO.1 1869 CDS 100% 10.800 15.120 N Ptprk n/a
5 TRCN0000336468 TACTTGCTGATCCAACTAAAT pLKO_005 1516 CDS 100% 13.200 10.560 N Ptprk n/a
6 TRCN0000220446 CCAGGATTTATACGATGACTT pLKO.1 741 CDS 100% 4.950 3.960 N Ptprk n/a
7 TRCN0000220445 CCCTATTACTTTGCCGCAGAA pLKO.1 2596 CDS 100% 4.050 3.240 N Ptprk n/a
8 TRCN0000336534 CCAATGAATACCAGGTAATAT pLKO_005 1079 CDS 100% 15.000 10.500 N Ptprk n/a
9 TRCN0000220444 GCCCAGACTAAGAACATAAAT pLKO.1 1318 CDS 100% 15.000 10.500 N Ptprk n/a
10 TRCN0000336532 GCCCAGACTAAGAACATAAAT pLKO_005 1318 CDS 100% 15.000 10.500 N Ptprk n/a
11 TRCN0000420364 TGAACCATCTGCCACCTTATA pLKO_005 1958 CDS 100% 13.200 9.240 N PTPRK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243144.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.