Transcript: Mouse XM_011243283.2

PREDICTED: Mus musculus bromodomain adjacent to zinc finger domain, 2A (Baz2a), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Baz2a (116848)
Length:
8888
CDS:
672..6338

Additional Resources:

NCBI RefSeq record:
XM_011243283.2
NBCI Gene record:
Baz2a (116848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243283.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262213 AGACGCCATTACTGGGTATTA pLKO_005 4005 CDS 100% 13.200 18.480 N Baz2a n/a
2 TRCN0000262210 AGGTGGAGCAGCATTACTTAA pLKO_005 4876 CDS 100% 13.200 18.480 N Baz2a n/a
3 TRCN0000262211 ATACTGAGTGAGGACGATAAA pLKO_005 2745 CDS 100% 13.200 18.480 N Baz2a n/a
4 TRCN0000262214 CTATCGTGTACGGGTTCTTTA pLKO_005 6941 3UTR 100% 13.200 18.480 N Baz2a n/a
5 TRCN0000075426 CCTCCTCTAAACCAATGAATA pLKO.1 4690 CDS 100% 13.200 10.560 N Baz2a n/a
6 TRCN0000075427 GCCTCCTCTAAACCAATGAAT pLKO.1 4689 CDS 100% 5.625 4.500 N Baz2a n/a
7 TRCN0000015568 CGGCCAGTAAAGTGGACTTAA pLKO.1 6777 3UTR 100% 13.200 9.240 N BAZ2A n/a
8 TRCN0000262212 CTGCTTCCTCATGGCATATAG pLKO_005 3467 CDS 100% 13.200 9.240 N Baz2a n/a
9 TRCN0000075423 GCACAGTTACTGAAGATGAAA pLKO.1 4066 CDS 100% 5.625 3.938 N Baz2a n/a
10 TRCN0000075424 CCAGGATGTAAGCAGTGACAT pLKO.1 1283 CDS 100% 4.950 3.465 N Baz2a n/a
11 TRCN0000075425 CCGACCTCGAAACAATGAGAA pLKO.1 2603 CDS 100% 4.950 3.465 N Baz2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243283.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.