Transcript: Mouse XM_011243741.2

PREDICTED: Mus musculus RAN binding protein 17 (Ranbp17), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ranbp17 (66011)
Length:
2464
CDS:
521..2410

Additional Resources:

NCBI RefSeq record:
XM_011243741.2
NBCI Gene record:
Ranbp17 (66011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243741.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072152 CCCAACAGTGTTCATTACTTA pLKO.1 1637 CDS 100% 5.625 4.500 N Ranbp17 n/a
2 TRCN0000072151 GCCATTGTTGTGAGAGATAAT pLKO.1 1781 CDS 100% 13.200 9.240 N Ranbp17 n/a
3 TRCN0000072149 CCCGAATCAATCCTTTACCTA pLKO.1 735 CDS 100% 3.000 2.100 N Ranbp17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243741.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.