Transcript: Mouse XM_011244063.2

PREDICTED: Mus musculus signal-induced proliferation-associated 1 like 1 (Sipa1l1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sipa1l1 (217692)
Length:
7905
CDS:
773..6163

Additional Resources:

NCBI RefSeq record:
XM_011244063.2
NBCI Gene record:
Sipa1l1 (217692)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244063.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106107 GCCATCTTACACGTTGGGAAT pLKO.1 5638 CDS 100% 4.050 5.670 N Sipa1l1 n/a
2 TRCN0000106108 CGGATATAAGTGGCAGTGGAA pLKO.1 4347 CDS 100% 2.640 2.112 N Sipa1l1 n/a
3 TRCN0000106109 CGCCACTAGCAAATATCTGAT pLKO.1 5182 CDS 100% 4.950 3.465 N Sipa1l1 n/a
4 TRCN0000106106 GCCATTATGAACAGACATAAT pLKO.1 1808 CDS 100% 1.320 0.924 N Sipa1l1 n/a
5 TRCN0000106105 GCACCCATTCACGCCTTGGAA pLKO.1 6218 3UTR 100% 1.000 0.700 N Sipa1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244063.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.