Transcript: Mouse XM_011244132.2

PREDICTED: Mus musculus fibronectin leucine rich transmembrane protein 2 (Flrt2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Flrt2 (399558)
Length:
7106
CDS:
781..2763

Additional Resources:

NCBI RefSeq record:
XM_011244132.2
NBCI Gene record:
Flrt2 (399558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113626 CCATGCCTCTTATTTGAACAA pLKO.1 2322 CDS 100% 4.950 6.930 N Flrt2 n/a
2 TRCN0000113628 CGGAAAGACGACTATTGTGAA pLKO.1 2530 CDS 100% 4.950 6.930 N Flrt2 n/a
3 TRCN0000113629 GCGCGGAATAACCCTTGGTTT pLKO.1 1699 CDS 100% 4.950 6.930 N Flrt2 n/a
4 TRCN0000062640 CCTCCACAACAACCAAATTAA pLKO.1 987 CDS 100% 15.000 10.500 N FLRT2 n/a
5 TRCN0000113627 GCTTGGTTAATTTAGAGCCCA pLKO.1 2216 CDS 100% 0.660 0.462 N Flrt2 n/a
6 TRCN0000113625 CCCACCTATTTCTGAAAGGAT pLKO.1 2034 CDS 100% 3.000 1.800 N Flrt2 n/a
7 TRCN0000062641 GTCTCCTTAAATAACGATCAA pLKO.1 2608 CDS 100% 4.950 6.930 N FLRT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.