Transcript: Mouse XM_011244299.1

PREDICTED: Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 6a (Serpinb6a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Serpinb6a (20719)
Length:
1457
CDS:
207..1343

Additional Resources:

NCBI RefSeq record:
XM_011244299.1
NBCI Gene record:
Serpinb6a (20719)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313471 ACGGTGAGGTGCATGAGATTC pLKO_005 1227 CDS 100% 10.800 15.120 N Serpinb6a n/a
2 TRCN0000313470 GGAAGTAACTTACGAGAAATT pLKO_005 950 CDS 100% 13.200 9.240 N Serpinb6a n/a
3 TRCN0000080474 TGACCTATATTGGAGAGATAT pLKO.1 835 CDS 100% 13.200 9.240 N Serpinb6a n/a
4 TRCN0000317083 TGACCTATATTGGAGAGATAT pLKO_005 835 CDS 100% 13.200 9.240 N Serpinb6a n/a
5 TRCN0000080473 CCATGTTAAGACCAATGGAAT pLKO.1 1292 CDS 100% 4.950 3.465 N Serpinb6a n/a
6 TRCN0000317084 CCATGTTAAGACCAATGGAAT pLKO_005 1292 CDS 100% 4.950 3.465 N Serpinb6a n/a
7 TRCN0000092279 GCACACAGTACTTGCTCAGAA pLKO.1 460 CDS 100% 4.950 3.465 N LOC436036 n/a
8 TRCN0000080476 GAGAATTACAACATGAACGAT pLKO.1 1044 CDS 100% 3.000 2.100 N Serpinb6a n/a
9 TRCN0000080475 CCAGGTACAGTGAATTCTGAT pLKO.1 666 CDS 100% 0.000 0.000 N Serpinb6a n/a
10 TRCN0000317082 CCAGGTACAGTGAATTCTGAT pLKO_005 666 CDS 100% 0.000 0.000 N Serpinb6a n/a
11 TRCN0000296533 CCTGTGCAAATGATGTTTAAG pLKO_005 798 CDS 100% 13.200 7.920 N SERPINB6 n/a
12 TRCN0000080477 AGCAGTTTAACAAAGAGCATA pLKO.1 736 CDS 100% 4.950 2.970 N Serpinb6a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.