Transcript: Mouse XM_011244405.2

PREDICTED: Mus musculus centromere protein P (Cenpp), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cenpp (66336)
Length:
911
CDS:
209..844

Additional Resources:

NCBI RefSeq record:
XM_011244405.2
NBCI Gene record:
Cenpp (66336)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244405.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177398 GTAAACTTACTGGCTTCAATA pLKO.1 420 CDS 100% 13.200 18.480 N Cenpp n/a
2 TRCN0000197582 CGTGAGAACACATTTAAGCAT pLKO.1 743 CDS 100% 3.000 4.200 N Cenpp n/a
3 TRCN0000200232 CGGAGCCTGGAAATCATTTCA pLKO.1 307 CDS 100% 5.625 3.938 N Cenpp n/a
4 TRCN0000197947 GAGCCTGGAAATCATTTCAAA pLKO.1 309 CDS 100% 5.625 3.938 N Cenpp n/a
5 TRCN0000176623 CCAAGATGGAAGACATTGTAA pLKO.1 453 CDS 100% 5.625 3.375 N Cenpp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244405.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.