Transcript: Mouse XM_011244471.2

PREDICTED: Mus musculus versican (Vcan), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vcan (13003)
Length:
8015
CDS:
454..6600

Additional Resources:

NCBI RefSeq record:
XM_011244471.2
NBCI Gene record:
Vcan (13003)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244471.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240554 AGCTAGTCCGGAGATTGATAA pLKO_005 4548 CDS 100% 13.200 18.480 N Vcan n/a
2 TRCN0000240556 ACTGCGGAGCACACGTAAATA pLKO_005 7570 3UTR 100% 15.000 12.000 N Vcan n/a
3 TRCN0000216596 GTCAACTACCATGCAATTTAA pLKO.1 837 CDS 100% 15.000 10.500 N Vcan n/a
4 TRCN0000240553 TTGGTAGTACATACCTTATAG pLKO_005 4790 CDS 100% 13.200 9.240 N Vcan n/a
5 TRCN0000217660 GTCGATTGAGTGATATGATTG pLKO.1 458 CDS 100% 10.800 7.560 N Vcan n/a
6 TRCN0000175555 CCTTTGAGCATAGCAGTAGTA pLKO.1 1862 CDS 100% 4.950 3.465 N Vcan n/a
7 TRCN0000175477 CTTCACTCATCATTTCAGCCA pLKO.1 6623 3UTR 100% 0.660 0.396 N Vcan n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244471.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.