Transcript: Mouse XM_011244484.2

PREDICTED: Mus musculus Fanconi anemia, complementation group C (Fancc), transcript variant X15, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fancc (14088)
Length:
2831
CDS:
434..1918

Additional Resources:

NCBI RefSeq record:
XM_011244484.2
NBCI Gene record:
Fancc (14088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240589 TGCTTCCCTATGTCTAGTAAA pLKO_005 2412 3UTR 100% 13.200 18.480 N Fancc n/a
2 TRCN0000240587 AGTCTTGGATATGAGTCTATT pLKO_005 554 CDS 100% 13.200 9.240 N Fancc n/a
3 TRCN0000240586 TAATGGACTGAGCACTCAAAG pLKO_005 643 CDS 100% 10.800 7.560 N Fancc n/a
4 TRCN0000179156 GCATTCAGATTCGACATGAAA pLKO.1 512 CDS 100% 5.625 3.938 N Fancc n/a
5 TRCN0000180671 GCGGTCCATGAGTATTATGAA pLKO.1 2074 3UTR 100% 5.625 3.938 N Fancc n/a
6 TRCN0000183932 CCAGAAGTACTAGCTGCTCTT pLKO.1 1070 CDS 100% 4.050 2.835 N Fancc n/a
7 TRCN0000240588 GGTGGAGCTGAAGGTATTAAT pLKO_005 1477 CDS 100% 15.000 9.000 N Fancc n/a
8 TRCN0000240590 TACTATCCTAGTTTGCTTAAA pLKO_005 578 CDS 100% 13.200 7.920 N Fancc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.