Transcript: Mouse XM_011244904.2

PREDICTED: Mus musculus MYC binding protein 2 (Mycbp2), transcript variant X22, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mycbp2 (105689)
Length:
14863
CDS:
79..14172

Additional Resources:

NCBI RefSeq record:
XM_011244904.2
NBCI Gene record:
Mycbp2 (105689)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250175 GTGTTAGTAAGGCCTATAAAT pLKO_005 14640 3UTR 100% 15.000 21.000 N Mycbp2 n/a
2 TRCN0000250176 AGATCGCTACCGGAGGATTTA pLKO_005 300 CDS 100% 13.200 18.480 N Mycbp2 n/a
3 TRCN0000193399 CCATGAATAGATACGCATATT pLKO.1 13739 CDS 100% 13.200 18.480 N Mycbp2 n/a
4 TRCN0000250173 CTCACGGCCAAGCGTCTATTA pLKO_005 4115 CDS 100% 13.200 18.480 N Mycbp2 n/a
5 TRCN0000216528 GACGTCTCTAGAATTAGTTAA pLKO.1 5463 CDS 100% 13.200 18.480 N Mycbp2 n/a
6 TRCN0000250177 GACGTCTCTAGAATTAGTTAA pLKO_005 5463 CDS 100% 13.200 18.480 N Mycbp2 n/a
7 TRCN0000194176 GCGGTATATTGCCATAACAAT pLKO.1 7182 CDS 100% 5.625 7.875 N Mycbp2 n/a
8 TRCN0000175602 CCGTGTACATAATTCTTGCTA pLKO.1 14318 3UTR 100% 3.000 4.200 N Mycbp2 n/a
9 TRCN0000250174 CATGAATAGATACGCATATTA pLKO_005 13740 CDS 100% 15.000 10.500 N Mycbp2 n/a
10 TRCN0000034292 CCAAAGAACATGCTCCTATAA pLKO.1 9320 CDS 100% 13.200 9.240 N MYCBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.