Transcript: Mouse XM_011244944.2

PREDICTED: Mus musculus docking protein 2 (Dok2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dok2 (13449)
Length:
1988
CDS:
734..1567

Additional Resources:

NCBI RefSeq record:
XM_011244944.2
NBCI Gene record:
Dok2 (13449)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244944.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421060 AGGGCTCTGCAAGGAATATAT pLKO_005 769 CDS 100% 15.000 21.000 N Dok2 n/a
2 TRCN0000077432 CTACAGGTTTCTTCGACGCTT pLKO.1 919 CDS 100% 2.640 3.696 N Dok2 n/a
3 TRCN0000077429 GCCGTGTTATATGGAGAGTCT pLKO.1 419 5UTR 100% 2.640 3.696 N Dok2 n/a
4 TRCN0000420793 AGCCAGGCACACAGCTATATG pLKO_005 891 CDS 100% 13.200 9.240 N Dok2 n/a
5 TRCN0000077428 CCATTTCTCTTAAGAGACAAA pLKO.1 1812 3UTR 100% 4.950 3.465 N Dok2 n/a
6 TRCN0000077431 GACCCACTGTATGACAGCATT pLKO.1 1322 CDS 100% 4.950 3.465 N Dok2 n/a
7 TRCN0000165885 GAGGGCAACTTTGAGTTCGAA pLKO.1 995 CDS 100% 3.000 2.100 N DOK2 n/a
8 TRCN0000077430 ACTGAGTATGACAATGTCATA pLKO.1 1526 CDS 100% 0.495 0.347 N Dok2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244944.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.