Transcript: Mouse XM_011245012.2

PREDICTED: Mus musculus WD repeat and HMG-box DNA binding protein 1 (Wdhd1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdhd1 (218973)
Length:
2849
CDS:
256..2079

Additional Resources:

NCBI RefSeq record:
XM_011245012.2
NBCI Gene record:
Wdhd1 (218973)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366054 TCCTTCGACTGTTCACTATTG pLKO_005 1892 CDS 100% 10.800 15.120 N Wdhd1 n/a
2 TRCN0000085791 CGCTGCTATAACGACGATCAA pLKO.1 1600 CDS 100% 4.950 6.930 N Wdhd1 n/a
3 TRCN0000365978 GTCTCCCTGTGGGCAGTATTT pLKO_005 969 CDS 100% 13.200 9.240 N Wdhd1 n/a
4 TRCN0000365980 TGTGAAAGTGCTGATGAATTA pLKO_005 1735 CDS 100% 13.200 9.240 N Wdhd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.