Transcript: Mouse XM_011245045.2

PREDICTED: Mus musculus PHD finger protein 11B (Phf11b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phf11b (236451)
Length:
1412
CDS:
161..976

Additional Resources:

NCBI RefSeq record:
XM_011245045.2
NBCI Gene record:
Phf11b (236451)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367000 GCTGTTTGAAGATACATTAAT pLKO_005 721 CDS 100% 15.000 10.500 N Phf11b n/a
2 TRCN0000367053 GAGCTTTGCTCAGCCTTAAAT pLKO_005 1198 3UTR 100% 15.000 7.500 Y Phf11b n/a
3 TRCN0000376127 GATCATGGCACTTACAAATTA pLKO_005 485 CDS 100% 15.000 7.500 Y Phf11b n/a
4 TRCN0000376128 GCCATGAGTGGAGTCAAATAT pLKO_005 195 CDS 100% 15.000 7.500 Y Phf11b n/a
5 TRCN0000376129 CAAGAAGTAATCAAGAGTAAA pLKO_005 749 CDS 100% 13.200 6.600 Y Phf11b n/a
6 TRCN0000085850 GCACCAAGAATTACCACTTAT pLKO.1 423 CDS 100% 13.200 6.600 Y Phf11a n/a
7 TRCN0000366999 GGCTCCTGATCTACCTAATAC pLKO_005 289 CDS 100% 13.200 6.600 Y Phf11b n/a
8 TRCN0000366998 GCCATGGAAGACCACGCAATT pLKO_005 449 CDS 100% 10.800 5.400 Y Phf11b n/a
9 TRCN0000085883 CTCAGCCTTAAATGGAATCTT pLKO.1 1206 3UTR 100% 5.625 2.813 Y Phf11d n/a
10 TRCN0000085848 TCAGCCTTAAATGGAATCTTA pLKO.1 1207 3UTR 100% 5.625 2.813 Y Phf11a n/a
11 TRCN0000085852 CACGCAATTCTACAAGTTGAT pLKO.1 461 CDS 100% 4.950 2.475 Y Phf11a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.