Transcript: Mouse XM_011245220.2

PREDICTED: Mus musculus zinc finger, MYM-type 2 (Zmym2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zmym2 (76007)
Length:
7011
CDS:
352..4560

Additional Resources:

NCBI RefSeq record:
XM_011245220.2
NBCI Gene record:
Zmym2 (76007)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071325 GCATAGTTACATATTGCGAAT pLKO.1 2375 CDS 100% 4.050 5.670 N Zmym2 n/a
2 TRCN0000071324 CCAGTAACTTTGGTGTGAATA pLKO.1 1052 CDS 100% 13.200 9.240 N Zmym2 n/a
3 TRCN0000118856 GCGAAACTCTTTACCTCAATA pLKO.1 2112 CDS 100% 13.200 9.240 N ZMYM2 n/a
4 TRCN0000071323 GCGTGGAAACATTGGGTCAAA pLKO.1 3658 CDS 100% 4.950 3.465 N Zmym2 n/a
5 TRCN0000071327 GCTCCAAAGAAACTCTGTGTT pLKO.1 1450 CDS 100% 4.950 3.465 N Zmym2 n/a
6 TRCN0000071326 GCTGAGCTTAACTATGGGTTA pLKO.1 3772 CDS 100% 4.050 2.835 N Zmym2 n/a
7 TRCN0000420141 ATACTTCCAGATGGGTCAATA pLKO_005 3982 CDS 100% 13.200 9.240 N ZMYM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.