Transcript: Mouse XM_011245226.2

PREDICTED: Mus musculus ubiquitin specific peptidase 54 (Usp54), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp54 (78787)
Length:
5571
CDS:
37..4587

Additional Resources:

NCBI RefSeq record:
XM_011245226.2
NBCI Gene record:
Usp54 (78787)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030910 CCCTCTGTAACCAGGCTATTT pLKO.1 215 CDS 100% 13.200 9.240 N Usp54 n/a
2 TRCN0000037263 CCAGACTTCATTGACTTCAAA pLKO.1 2973 CDS 100% 5.625 3.938 N Usp54 n/a
3 TRCN0000037259 CCCAACTTACACTCTTTGTTT pLKO.1 5180 3UTR 100% 5.625 3.938 N Usp54 n/a
4 TRCN0000030913 GTAGGAATGATCTGTTACTAT pLKO.1 526 CDS 100% 5.625 3.938 N Usp54 n/a
5 TRCN0000030909 GCACCACAGATTATCACGATT pLKO.1 373 CDS 100% 4.950 3.465 N Usp54 n/a
6 TRCN0000037262 GCCAGATATGTACCAAGGAAA pLKO.1 3354 CDS 100% 4.950 3.465 N Usp54 n/a
7 TRCN0000037260 CCAGGATAGAAGTTTGCCAAA pLKO.1 3117 CDS 100% 4.050 2.835 N Usp54 n/a
8 TRCN0000037261 CCCTTAGGTCAACTTGGAATT pLKO.1 4370 CDS 100% 0.000 0.000 N Usp54 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.